GGT GAT GGT GGT GTC GAG ATC TGA GTC CGG ACT T 3′. This PCR item contained the recognition web-sites for BamHI and AgeI and was cloned into PLEXMCS as described above to over express eGFP with Cterm His tag. Precisely the same PCR product was employed to make the fusion constructs eGFPSegment 2 and eGFPSegment three by using the KpnI recognition website. Second, a PCR solution for Segment 2 and Segment 3 containing a KpnI recognition website in the 5′ was obtained with the following set of primers: KpnISegment 2 F: 5′ GGG GTA CCAC TAC CAT GGT TCC AAG TCC AG 3′ R: the primer described above for Segment two; KpnISegment 3 F: 5’GGG GTA CCA GTG TCA AAC AGA ATG GTC CTA AA 3′ R: the primer described above for Segment three. Third, the PCR solutions for eGFP, KpnISegment two and KpnISegment three were digested with KpnI plus a ligation was performed between eGFP and Segment two and Segment 3. These ligations have been used as templates to acquire the fusion clones eGFPSegment two and eGFPSegment three by utilizing the Forward primer to amplify eGFP plus the Reverse primers for Segment two and Segment 3 described above. These PCR solutions were digested with BamHI and AgeI and had been cloned into PLEXMCS. The generation of your modified Segment three with all codons substituted with synonym codons was performed manually applying a typical codon table as a reference. The construct containing the modified sequence was synthesized by IDT DNA technologies using gblock technology. This synthetic construct was fused with an eGFP PCR solution obtained from the eGFP His construct described above employing the primers F: 5′ ATA GAA GAC ACC GAC TCT ACT AGA GGA TCC GCC GCC ACC ATG GTG AG 3′ and R: 5′ GGG CGT CTT TGG GCC GTT TTG CTT AAC CGA TTA CTA ATG ATG GTG ATG GTG GT 3′.Fmoc-D-Cys(Trt)-OH site The gibson assembly system [14] with all the gibson enzyme mix from New England Biolabs was utilised, and was then cloned into PLEXMCS previously digested with BamHIAgeI.tert-Butyl (3-iodopropyl)carbamate Chemical name The sequence on the modified Nrf2 segment three is as follows: TCGGTTAAGCAAAACGGCCCAAAGACGCCCGTCCACTCGTCAGGTGACATGGTC CAGCCACTGTCCCCCTCGCAAGGACAAAGTACGCATGTACACGACGCTCAGTGC GAAAATACCCCCGAAAAGGAGCTACCCGTGTCCCCCGGGCACAGAAAGACGCC CTTTACGAAGGATAAGCACTCCTCCAGGTTAGAAGCCCACCTAACGCGCGACGA GCTCCGAGCGAAGGCGTTACACATACCCTTTCCCGTGGAGAAGATAATAAATTT GCCGGTAGTCGATTTTAATGAGATGATGAGTAAGGAACAATTTAACGAGGCCCA GCTAGCGTTGATAAGGGACATCAGACGCCGAGGAAAAAACAAGGTAGCAGCGC AAAACTGTCGGAAGCGGAAGTTAGAGAACATCGTGGAGCTCGAACAGGACCTC GACCACCTAAAGGACGAGAAGGAGAAGCTCCTAAAGGAGAAGGGGGAGAACG ATAAGTCATTGCATTTGCTAAAGAAGCAGTTGTCGACTTTGTACTTAGAGGTATT TTCTATGTTGCGGGACGAGGACGGCAAGCCCTACTCGCCCTCAGAGTATTCGCT CCAACAGACCCGAGACGGTAACGTCTTTCTAGTCCCTAAGTCCAAAAAACCCGA CGTGAAAAAGAATNIHPA Author Manuscript NIHPA Author Manuscript NIHPA Author ManuscriptBiochem Biophys Res Commun.PMID:24605203 Author manuscript; out there in PMC 2014 July 19.PerezLeal et al.PageTo produce a full length Nrf2 using the mutated segment 3 described above, two PCR fragments corresponding to a item containing the wild variety sequence for segment 1 and two along with the other containing the sequence on the mutated segment 3 had been fused with each other employing the gibson assembly mix (New England biolabs). The fragment containing segments 1 was obtained together with the primer set: F: 5′ ATA GAA GAC ACC GAC TCT ACT AGA GGA TCC GCC GCC ACC ATG ATG GAC T 3′ R: 5′ GGG CGT CTT TGG GCC GTT TTG CTT AAC CGA TCC AGG GGC ACT ATC TAG CTC TT 3′ and the mutant segment 3 with the set: F 5′ TCG GTT AAG CAA AAC GGC 3′ R: 5′ GTT GGC GCA GCA GCC GGG GCA GCA ACC GGT ATT CTT TTT CAC GTC GGG TTT 3′. The fusion of these PCR fragments was performed i.
